crispresso2

Link to section 'Introduction' of 'crispresso2' Introduction

CRISPResso2 is a software pipeline designed to enable rapid and intuitive interpretation of genome editing experiments.

Docker hub: https://hub.docker.com/r/pinellolab/crispresso2
Home page: https://github.com/pinellolab/CRISPResso2

Link to section 'Versions' of 'crispresso2' Versions

  • 2.2.10
  • 2.2.11a
  • 2.2.8
  • 2.2.9

Link to section 'Commands' of 'crispresso2' Commands

  • CRISPResso
  • CRISPRessoAggregate
  • CRISPRessoBatch
  • CRISPRessoCompare
  • CRISPRessoPooled
  • CRISPRessoPooledWGSCompare
  • CRISPRessoWGS

Link to section 'Module' of 'crispresso2' Module

You can load the modules by:

module load biocontainers
module load crispresso2

Link to section 'Example job' of 'crispresso2' Example job

Using #!/bin/sh -l as shebang in the slurm job script will cause the failure of some biocontainer modules. Please use #!/bin/bash instead.

To run crispresso2 on our clusters:

#!/bin/bash
#SBATCH -A myallocation     # Allocation name
#SBATCH -t 1:00:00
#SBATCH -N 1
#SBATCH -n 1
#SBATCH --job-name=crispresso2
#SBATCH --mail-type=FAIL,BEGIN,END
#SBATCH --error=%x-%J-%u.err
#SBATCH --output=%x-%J-%u.out

module --force purge
ml biocontainers crispresso2

CRISPResso --fastq_r1 nhej.r1.fastq.gz --fastq_r2 nhej.r2.fastq.gz -n nhej --amplicon_seq \
    AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT
Helpful?

Thanks for letting us know.

Please don't include any personal information in your comment. Maximum character limit is 250.
Characters left: 250
Thanks for your feedback.